whiA [2019-02-08 18:10:57]

WhiA family protein, involved in Z ring assembly, required for normal chromosome segregation

Locus: BSU34750

Isoelectric point: 9.48

Molecular weight: 36.18 kDa

Protein length: 316 aa

Gene length: 951 bp

Function: control of Z ring asembly and chromosome segregation

Product: Cell division protein

Essential: no

Synonyms: yvcL

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell division → Other genes
• Information processing → Genetics → DNA condensation/ segregation
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factor/ other/ based on similarity

Gene

Coordinates: 3,569,573 3,570,523

Phenotypes of a mutant

• a whiA zapA double mutant grows poorly, and the cells are filamentous (due to a defect in Z ring assembly) PubMed
• a whiA ezrA double mutant grows poorly, and the cells are filamentous PubMed
• a whiA minC-minD mutant grows poorly, and the cells are filamentous PubMed
• a whiA noc double mutant grows poorly, and the cells are filamentous PubMed
• a whiA parB double mutant is not viable, this can be suppressed by inactivation of yneA PubMed
• a whiA yabA double mutant is not viable PubMed
• the defects of the whiA zapA double mutant can be suppressed by inactivation of either gtaB, pgcA, or ugtP PubMed
• highly sensitive for DNA damaging agents PubMed

The protein

Protein family

• WhiA family PubMed

Domains

• suggested HTH domain at the N terminus PubMed

Structure

• 3HYI (Crystal structure of full-length DUF199/WhiA from Thermotoga maritima)
• 3HYJ (Crystal structure of the N-terminal LAGLIDADG domain of DUF199/WhiA)

Localization

• localizes to the nucleoid PubMed

Expression and Regulation

Operons

• Genes: nahA-yvcJ-glmR-whiA-crh-yvcN
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, in CcpA regulon

  Regulation

  • constitutive expression at both protein and RNA levels PubMed

  Additional information

  • A ncRNA is predicted between 'yvcI' and 'trxB' PubMed

Biological materials

Mutant

• MGNA-B639 (yvcL::erm), available at the NBRP B. subtilis, Japan
• GP231 (amyE::PrpsJ-lacZ, yvcL::cat) available in Jrg Stlke's lab; plasmid pGP1468 was used to disrupt the gene.
• BKE34750 (whiA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAGCCACCTCATTTCA, downstream forward: _UP4_TAACCGTAAAGAAAAGGGGA
• BKK34750 (whiA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAGCCACCTCATTTCA, downstream forward: _UP4_TAACCGTAAAGAAAAGGGGA

Expression vectors

• pGP1469 for expression in B. subtilis (in pGP382, with C-terminal STREP-TAG), available in Jrg Stlke's lab
• pGP2429 (N-terminal Strep-Tag, purification from E. coli and/or B. subtilis, in pDG148), for SPINE, available in Jrg Stlke's lab
• pGP2430 (C-terminal Strep-Tag, purification from E. coli and/or B. subtilis, in pDG148), for SPINE, available in Jrg Stlke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's and Boris Grke's labs

FLAG-tag construct

• GP782 (spc, based on pGP1331), available in Jrg Stlke's lab

Antibody

• available in Leendert Hamoen's lab PubMed

References

Loading